PSMB1 cDNA ORF Clone, Mouse, untagged

Cat: MG51327-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All PSMB1 Reagents

CRO Services

Product recommended


All PSMB1 Reagents

PSMB1 cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
723 bp
Description
Full length Clone DNA of Mouse proteasome (prosome, macropain) subunit, beta type 1.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMB1 cDNA ORF Clone, Mouse, untagged Alternative Names

AA409053 cDNA ORF Clone, Mouse;C81484 cDNA ORF Clone, Mouse;Lmpc5 cDNA ORF Clone, Mouse

PSMB1 Background Information

Full Name
proteasome (prosome, macropain) subunit, beta type, 1

PSMB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMB1 cDNA ORF Clone in Cloning Vector, Mouse MG51327-U
PSMB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51327-ACGLN
PSMB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51327-ACG
PSMB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51327-ANG
PSMB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51327-ACR
PSMB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51327-ANR
PSMB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51327-CF
PSMB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51327-NF
PSMB1 cDNA ORF Clone, Mouse, C-His tag MG51327-CH
PSMB1 cDNA ORF Clone, Mouse, N-His tag MG51327-NH
PSMB1 cDNA ORF Clone, Mouse, C-HA tag MG51327-CY
PSMB1 cDNA ORF Clone, Mouse, N-HA tag MG51327-NY
PSMB1 cDNA ORF Clone, Mouse, C-Myc tag MG51327-CM
PSMB1 cDNA ORF Clone, Mouse, N-Myc tag MG51327-NM
PSMB1 qPCR Primer Pairs, Mouse MP201204

PSMB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMB1 cDNA ORF Clone in Cloning Vector, Human HG14295-G
PSMB1 cDNA ORF Clone, Human, untagged HG14295-UT
PSMB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14295-ACG
PSMB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14295-ACGLN
PSMB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14295-ANG
PSMB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14295-ACR
PSMB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14295-ANR
PSMB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14295-CF
PSMB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14295-NF
PSMB1 cDNA ORF Clone, Human, C-His tag HG14295-CH
PSMB1 cDNA ORF Clone, Human, N-His tag HG14295-NH
PSMB1 cDNA ORF Clone, Human, C-HA tag HG14295-CY
PSMB1 cDNA ORF Clone, Human, N-HA tag HG14295-NY
PSMB1 cDNA ORF Clone, Human, C-Myc tag HG14295-CM
PSMB1 cDNA ORF Clone, Human, N-Myc tag HG14295-NM
PSMB1 qPCR Primer Pairs, Human HP102945
info info
添加购物车成功! 添加购物车失败!