Быстрый заказ

Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PSMB1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:U60824.1
    Размер кДНК:723bp
    Описание кДНК:Full length Clone DNA of Mus musculus proteasome (prosome, macropain) subunit, beta type 1.
    Синоним гена:Lmpc5, C81484, AA409053
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PSMB1 qPCR primers for gene expression analysis, MP201204 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51327-ACGRBS15400
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51327-ACRRBS15400
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51327-ANGRBS15400
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51327-ANRRBS15400
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51327-CFRBS13340
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51327-CHRBS13340
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51327-CMRBS13340
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51327-CYRBS13340
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51327-NFRBS13340
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51327-NHRBS13340
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51327-NMRBS13340
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51327-NYRBS13340
    Мышь PSMB1 Джин клон кДНК в вектор клонированияMG51327-URBS5130
    Мышь PSMB1 Джин ORF экспрессии кДНК клона плазмидыMG51327-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51327-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».