After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse FOLH1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016770.2
Размер кДНК:2259bp
Описание кДНК:Full length Clone DNA of Mus musculus folate hydrolase with N terminal Myc tag.
Синоним гена:mopsm, MGC141397, Folh1
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-mFOLH1
Участок рестрикции:HindIII + XbaI (6kb + 2.35kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1842G/A, 2345C/T, 2347T/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse FOLH1 Gene Plasmid Map
Mouse PSMA / FOLH1 ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50214-ACGRBS16760
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50214-ACRRBS16760
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50214-CFRBS14710
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50214-CHRBS14710
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50214-CMRBS14710
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50214-CYRBS14710
Мышь PSMA/FOLH1/GCPII Джин клон кДНК в вектор клонированияMG50214-MRBS5130
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50214-NFRBS14710
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50214-NHRBS14710
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50214-NMRBS14710
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50214-NYRBS14710
Мышь PSMA/FOLH1/GCPII Джин ORF экспрессии кДНК клона плазмидыMG50214-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Glutamate carboxypeptidase 2, also known as Glutamate carboxypeptidase II, Membrane glutamate carboxypeptidase, Prostate-specific membrane antigen, GCPII, PSMA, FOLH1, and NAALAD1, is a single-pass type I I membrane protein which belongs to the peptidase M28 family and M28B subfamily. FOLH1 is highly expressed in prostate epithelium. It is detected in urinary bladder, kidney, testis, ovary, fallopian tube, breast, adrenal gland, liver, esophagus, stomach, small intestine, colon, brain (at protein level), and the capillary endothelium of a variety of tumors. FOLH1 has both folate hydrolase and N-acetylated alpha linked acidic dipeptidase (NAALADase) activity. It has a preference for tri-alpha-glutamate peptides. Genetic variation in FOLH1 may be associated with low folate levels and consequent hyperhomocysteinemia. This condition can result in increased risk of cardiovascular disease, neural tube defects, and cognitive deficits. FOLH1 also shows a promising role in directed imaging and therapy of recurrent or metastatic disease.

Size / Price
Каталог: MG50214-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Mouse PSMA / FOLH1 ORF mammalian expression plasmid, N-Myc tag
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».