Быстрый заказ

Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PSAP Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_011179.3
    Размер кДНК:1674bp
    Описание кДНК:Full length Clone DNA of Mus musculus prosaposin with C terminal HA tag.
    Синоним гена:SGP-1, AI037048
    Виды:Mouse
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PSAP qPCR primers for gene expression analysis, MP201076 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51192-ACGRBS16760
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51192-ACRRBS16760
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51192-CFRBS14710
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51192-CHRBS14710
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51192-CMRBS14710
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51192-CYRBS14710
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51192-NFRBS14710
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51192-NHRBS14710
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51192-NMRBS14710
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51192-NYRBS14710
    Мышь PSAP/Prosaposin Джин клон кДНК в вектор клонированияMG51192-URBS5130
    Мышь PSAP/Prosaposin Джин ORF экспрессии кДНК клона плазмидыMG51192-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51192-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».