After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRSS3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011645.2
Размер кДНК:741bp
Описание кДНК:Full length Clone DNA of Mus musculus protease, serine, 3 with C terminal HA tag.
Синоним гена:Tb, MTG, TRY4, Try3
Виды:Mouse
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50499-ACGRBS15396
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50499-ACRRBS15396
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50499-CFRBS13343
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50499-CHRBS13343
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50499-CMRBS13343
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50499-CYRBS13343
Мышь Trypsin-3/PRSS3 Джин клон кДНК в вектор клонированияMG50499-MRBS5132
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50499-NFRBS13343
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50499-NHRBS13343
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50499-NMRBS13343
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50499-NYRBS13343
Мышь Trypsin-3/PRSS3 Джин ORF экспрессии кДНК клона плазмидыMG50499-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Trypsin-3, also known as Trypsin III, brain trypsinogen, Serine protease 3 and PRSS3, is a secreted protein which belongs to the peptidase S1 family. Trypsin-3 / PRSS3 is expressed is in pancreas and brain. It contains one peptidase S1 domain. Trypsin-3 / PRSS3 can degrade intrapancreatic trypsin inhibitors that protect against CP. Genetic variants that cause higher mesotrypsin activity might increase the risk for chronic pancreatitis (CP). A sustained imbalance of pancreatic proteases and their inhibitors seems to be important for the development of CP. The trypsin inhibitor-degrading activity qualified PRSS3 as a candidate for a novel CP susceptibility gene. Trypsin-3 / PRSS3 has been implicated as a putative tumor suppressor gene due to its loss of expression, which is correlated with promoter hypermethylation, in esophageal squamous cell carcinoma and gastric adenocarcinoma.

Ссылки
  • Venter JC. et al., 2001, Science 291:1304-51.
  • Marsit,CJ. et al., 2005, Mol Carcinog 44 (2):146-50.
  • Rowen, L. et al., 2005, Mol Biol Evol. 22 (8):1712-20.
  • Rosendahl, J. et al., 2010, Pancreatology. 10 (2-3):243-9
  • Size / Price
    Каталог: MG50499-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».