PRRG2 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

PRRG2 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Mouse proline-rich Gla (G-carboxyglutamic acid) polypeptide 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PRRG2 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

1600014G02Rik cDNA ORF Clone, Mouse; 2510041M06Rik cDNA ORF Clone, Mouse; N4WBP1 cDNA ORF Clone, Mouse

PRRG2 Background Information

The genes encoding a family of proteins termed proline-rich gamma-carboxyglutamic acid (PRRG) proteins were identified and characterized more than a decade ago. These novel membrane proteins have an extracellular gamma-carboxyglutamic acid (Gla) protein domain and cytosolic WW binding motifs. Several of the PRRG-interacting proteins are essential for a variety of physiologic processes.
Full Name
proline rich Gla (G-carboxyglutamic acid) 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait