Быстрый заказ

Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PRMT6 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_178891.4
    Размер кДНК:1137bp
    Описание кДНК:Full length Clone DNA of Mus musculus protein arginine N-methyltransferase 6 with N terminal Flag tag.
    Синоним гена:Hrmt1l6, AW124876, BB233495, Prmt6
    Виды:Mouse
    переносчик:pCMV3-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRMT6 qPCR primers for gene expression analysis, MP201010 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51052-ACGRBS15400
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51052-ACRRBS15400
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51052-ANGRBS15400
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51052-ANRRBS15400
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51052-CFRBS13340
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51052-CHRBS13340
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51052-CMRBS13340
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51052-CYRBS13340
    Мышь PRMT6 Джин клон кДНК в вектор клонированияMG51052-GRBS5130
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51052-NFRBS13340
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51052-NHRBS13340
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51052-NMRBS13340
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51052-NYRBS13340
    Мышь PRMT6 Джин ORF экспрессии кДНК клона плазмидыMG51052-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Protein arginine N-methyltransferase 6, also known as Histone-arginine N-methyltransferase PRMT6, PRMT6, and HRMT1L6, is a member of the protein arginine N-methyltransferase family and PRMT6 subfamily. PRMT6 is highly expressed in kidney and testes. PRMT6 is known to catalyze the generation of asymmetric dimethylarginine in polypeptides. It has been implicated in human immunodeficiency virus pathogenesis, DNA repair, and transcriptional regulation. PRMT6 is known to methylate histone H3 Arg-2 (H3R2), and this negatively regulates the lysine methylation of H3K4 resulting in gene repression. PRMT6 plays a key role in coupling process by functioning as a transcriptional coactivator that can regulate alternative splicing. PRMT6 coactivates the progesterone, glucocorticoid and oestrogen receptors in luciferase reporter assays in a hormone-dependent manner. Small interfering RNA (siRNA) oligonucleotide duplex knockdown of PRMT6 disrupts oestrogen-stimulated transcription of endogenous GREB1 and progesterone receptor in MCF-7 breast cancer cells. Neutralizing the activity of PRMT6 could inhibit tumor progression and may be of cancer therapeutic significance.

    Ссылки
  • Hyllus D, et al., 2007, Genes Dev. 21(24): 3369-80.
  • Lakowski, TM. et al., 2008, J Biol Chem. 283 (15): 10015-25. 
  • Michaud-Levesque, J. et al., 2009, J Biol Chem. 284 (32): 21338-46.
  • Harrison, MJ. et al., 2010, Nucleic acids Res. Jan 4.
  • Size / Price
    Каталог: MG51052-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».