After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRMT2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001077638.1
Размер кДНК:1338bp
Описание кДНК:Full length Clone DNA of Mus musculus protein arginine N-methyltransferase 2.
Синоним гена:Hrmt1l1, AI504737
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51376-ACGRBS15400
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51376-ACRRBS15400
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51376-ANGRBS15400
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51376-ANRRBS15400
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51376-CFRBS13340
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51376-CHRBS13340
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51376-CMRBS13340
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51376-CYRBS13340
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51376-NFRBS13340
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51376-NHRBS13340
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51376-NMRBS13340
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51376-NYRBS13340
Мышь PRMT2 Джин клон кДНК в вектор клонированияMG51376-URBS5130
Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмидыMG51376-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51376-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».