Быстрый заказ

Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PRMT2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001077638.1
    Размер кДНК:1338bp
    Описание кДНК:Full length Clone DNA of Mus musculus protein arginine N-methyltransferase 2.
    Синоним гена:Hrmt1l1, AI504737
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRMT2 qPCR primers for gene expression analysis, MP201249 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51376-ACGRBS15400
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51376-ACRRBS15400
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51376-ANGRBS15400
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51376-ANRRBS15400
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51376-CFRBS13340
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51376-CHRBS13340
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51376-CMRBS13340
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51376-CYRBS13340
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51376-NFRBS13340
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51376-NHRBS13340
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51376-NMRBS13340
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51376-NYRBS13340
    Мышь PRMT2 Джин клон кДНК в вектор клонированияMG51376-URBS5130
    Мышь PRMT2 Джин ORF экспрессии кДНК клона плазмидыMG51376-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51376-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».