After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRLR Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011169.4
Размер кДНК:1827bp
Описание кДНК:Full length Clone DNA of Mus musculus prolactin receptor with N terminal Flag tag.
Синоним гена:Pr-1, Pr-3, AI987712, Prlr-rs1
Виды:Mouse
переносчик:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-mPRLR
Участок рестрикции:KpnI + XbaI (6kb + 1.91kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse PRLR Gene Plasmid Map
Mouse PRLR natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50457-ACGRBS16760
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50457-ACRRBS16760
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50457-CFRBS14710
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50457-CHRBS14710
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50457-CMRBS14710
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50457-CYRBS14710
Мышь Prolactin Receptor Джин клон кДНК в вектор клонированияMG50457-MRBS5130
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50457-NFRBS14710
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50457-NHRBS14710
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50457-NMRBS14710
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50457-NYRBS14710
Мышь Prolactin Receptor Джин ORF экспрессии кДНК клона плазмидыMG50457-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Prolactin receptor (PRLR) is a single-pass transmembrane receptor belonging to the type â…  cytokine receptor superfamily, and contains two fibronectin type-â…¢ domains. All class 1 ligands activate their respective receptors by clustering mechanisms. Ligand binding results in the transmembrane PRLR dimerization, followed by phosphorylation and activation of the molecules invloved in the signaling pathways, such as Jak-STAT, Ras/Raf/MAPK. The PRLR contains no intrinsic tyrosine kinase cytoplasmic domain but associates with a cytoplasmic tyrosine kinase, JAK2. PRLR mainly serves as the receptor for the pituitary hormone prolactin (PRL), a secreted hormone that affects reproduction and homeostasis in vertebrates. PRLR can be regulated by an interplay of two different mechanisms, PRL or ovarian steroid hormones independently or in combination in a tissue-specific manner. The role of the hormone prolactin (PRL) in the pathogenesis of breast cancer is mediated by its cognate receptor (PRLR). Ubiquitin-dependent degradation of the PRLR that negatively regulates PRL signaling is triggered by PRL-mediated phosphorylation of PRLR on Ser349 followed by the recruitment of the beta-transducin repeats-containing protein (beta-TrCP) ubiquitin-protein isopeptide ligase. which altered PRLR stability may directly influence the pathogenesis of breast cancer.

Ссылки
  • Bole-Feysot C, et al. (1998) Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev. 19(3): 225-68.
  • Goffin V, et al. (1999) From the molecular biology of prolactin and its receptor to the lessons learned from knockout mice models. Genet Anal. 15(3-5): 189-201.
  • Li Y, et al. (2006) Stabilization of prolactin receptor in breast cancer cells. Oncogene. 25(13): 1896-902.
  • Shao R, et al. (2008) Differences in prolactin receptor (PRLR) in mouse and human fallopian tubes: evidence for multiple regulatory mechanisms controlling PRLR isoform expression in mice. Biol Reprod. 79(4): 748-57.
  • Size / Price
    Каталог: MG50457-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse PRLR natural ORF mammalian expression plasmid, N-Flag tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».