Быстрый заказ

Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRKCI Информация о продукте «Клон cDNA»
Размер кДНК:1788bp
Описание кДНК:Full length Clone DNA of Mus musculus protein kinase C, iota with N terminal Myc tag.
Синоним гена:Pkci, Pkcl, Prkcl, AI427505, KIAA4165, PKClambda, mKIAA4165, aPKClambda, 2310021H13Rik, Prkci
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50788-ACGRBS16760
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50788-ACRRBS16760
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50788-ANGRBS16760
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50788-ANRRBS16760
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50788-CFRBS14710
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50788-CHRBS14710
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50788-CMRBS14710
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50788-CYRBS14710
Мышь PKC iota Джин клон кДНК в вектор клонированияMG50788-GRBS5130
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50788-NFRBS14710
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50788-NHRBS14710
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50788-NMRBS14710
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50788-NYRBS14710
Мышь PKC iota Джин ORF экспрессии кДНК клона плазмидыMG50788-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Protein kinase C iota type, also known as Atypical protein kinase C-lambda/iota, aPKC-lambda/iota and PRKCI, is a cytoplasm, membrane and nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and PKC subfamily. PRKCI contains one AGC-kinase C-terminal domain, one OPR domain, one phorbol-ester/DAG-type zinc finger and one protein kinase domain. PRKCI is predominantly expressed in lung and brain, but also expressed at lower levels in many tissues including pancreatic islets. It is highly expressed in non-small cell lung cancers. PRKCI is a calcium-independent, phospholipid-dependent, serine- and threonine-specific kinase. It may play a role in the secretory response to nutrients. PRKCI is involved in cell polarization processes and the formation of epithelial tight junctions. It is implicated in the activation of several signaling pathways including Ras, c-Src and NF-kappa-B pathways. PRKCI functions in both pro- and anti-apoptotic pathways. It functions in the RAC1/ERK signaling required for transformed growth. PRKCI plays a role in microtubule dynamics through interaction with RAB2A and GAPDH and recruitment to vesicular tubular clusters (VTCs). PRKCI might be a target for novel lipid activators that are elevated during nutrient-stimulated insulin secretion.

  • Selbie L.A. et al.,1993, J. Biol. Chem. 268:24296-302.
  • Diaz-Meco M.T. et al.,1996, Mol. Cell. Biol. 16:105-114.
  • Noda Y. et al.,2001, Genes Cells 6:107-119.
  • White W.O.et al.,2002, J. Cell. Biochem. 85:42-53.
  • Messerschmidt A. et al., 2005, J. Mol. Biol. 352:918-931.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.