After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PREP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011156.2
Размер кДНК:2133bp
Описание кДНК:Full length Clone DNA of Mus musculus prolyl endopeptidase.
Синоним гена:PEP, AI047692
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50288-ACGRBS16760
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50288-ACRRBS16760
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50288-ANGRBS16760
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50288-ANRRBS16760
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50288-CFRBS14710
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50288-CHRBS14710
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50288-CMRBS14710
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50288-CYRBS14710
Мышь Prolyl endopeptidase / PREP Джин клон кДНК в вектор клонированияMG50288-MRBS5130
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50288-NFRBS14710
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50288-NHRBS14710
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50288-NMRBS14710
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50288-NYRBS14710
Мышь Prolyl endopeptidase / PREP Джин ORF экспрессии кДНК клона плазмидыMG50288-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

Ссылки
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • Size / Price
    Каталог: MG50288-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».