Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-His tag

Price:
Size:
Number:

Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Mouse peroxiredoxin 6 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Peroxiredoxin 6 cDNA ORF Clone, Mouse, N-His tag: Alternative Names

1-CysPrx cDNA ORF Clone, Mouse; 9430088D19Rik cDNA ORF Clone, Mouse; AA690119 cDNA ORF Clone, Mouse; aiPLA2 cDNA ORF Clone, Mouse; Aop2 cDNA ORF Clone, Mouse; Brp-12 cDNA ORF Clone, Mouse; CP-3 cDNA ORF Clone, Mouse; GPx cDNA ORF Clone, Mouse; Ltw-4 cDNA ORF Clone, Mouse; Ltw4 cDNA ORF Clone, Mouse; Lvtw-4 cDNA ORF Clone, Mouse; NSGPx cDNA ORF Clone, Mouse; ORF06 cDNA ORF Clone, Mouse; Prdx5 cDNA ORF Clone, Mouse

Peroxiredoxin 6 Background Information

PRDX6, a member of antioxidant protein superfamily, plays an important role in oxidative stress, catabolism of lipids and phospholipid lipisomes. Peroxiredoxin 6 (PRDX6) is involved in redox regulation of the cell and is thought to be protective against oxidant injury. Peroxiredoxin 6 (PRDX6) is a bifunctional protein with both glutathione peroxidase (GPx) and iPLA2 activities,which are concomitantly increased with the expression of PRDX6. PRDX6 promoted lung tumor growth in an in vivo allograft model.
Full Name
peroxiredoxin 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait