Быстрый заказ

Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRDX6 Информация о продукте «Клон cDNA»
Размер кДНК:675bp
Описание кДНК:Full length Clone DNA of Mus musculus peroxiredoxin 6 with N terminal His tag.
Синоним гена:GPx; Aop2; CP-3; Ltw4; Ltw-4; NSGPx; ORF06; Prdx5; Brp-12; Lvtw-4; aiPLA2; 1-cysPrx; AA690119; 1-Cys Prx; 9430088D19Rik
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51391-ACGRBS15396
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51391-ACRRBS15400
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51391-ANGRBS15396
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51391-ANRRBS15400
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51391-CFRBS13343
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51391-CHRBS13343
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51391-CMRBS13340
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51391-CYRBS13343
Мышь Peroxiredoxin 6/PRDX6 Джин клон кДНК в вектор клонированияMG51391-GRBS5132
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51391-NFRBS13343
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51391-NHRBS13343
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51391-NMRBS13343
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51391-NYRBS13343
Мышь Peroxiredoxin 6/PRDX6 Джин ORF экспрессии кДНК клона плазмидыMG51391-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51391-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.