Быстрый заказ

Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRDX5 Информация о продукте «Клон cDNA»
Размер кДНК:633bp
Описание кДНК:Full length Clone DNA of Mus musculus peroxiredoxin 5 with N terminal HA tag.
Синоним гена:AOPP, PrxV, Pmp20, Prdx6, AOEB166, Prdx5
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50551-ACGRBS15400
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50551-ACRRBS15400
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50551-ANGRBS15400
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50551-ANRRBS15400
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50551-CFRBS13340
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50551-CHRBS13340
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50551-CMRBS13340
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50551-CYRBS13340
Мышь Peroxiredoxin 5/PRDX5 Джин клон кДНК в вектор клонированияMG50551-MRBS5130
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50551-NFRBS13340
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50551-NHRBS13340
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50551-NMRBS13340
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50551-NYRBS13340
Мышь Peroxiredoxin 5/PRDX5 Джин ORF экспрессии кДНК клона плазмидыMG50551-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Peroxiredoxin-5, also known as Alu corepressor 1, Antioxidant enzyme B166, Liver tissue 2D-page spot 71B, Peroxisomal antioxidant enzyme, Thioredoxin peroxidase PMP20, Thioredoxin reductase, PRDX5 and ACR1, is cytoplasm protein which belongs to the?peroxiredoxin 2 family. Peroxiredoxin-5 / PRDX5 reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-5 / PRDX5 is involved in intracellular redox signaling. The Peroxiredoxins / Prx are a family of 25 kDa peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

  • Seo M.S., et al., 2000, J. Biol. Chem. 275: 20346-54.
  • Declercq J.-P., et al., 2001, J. Mol. Biol. 311:751-9.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Size / Price
    Каталог: MG50551-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.