After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRDX2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011563.5
Размер кДНК:597bp
Описание кДНК:Full length Clone DNA of Mus musculus peroxiredoxin 2 with N terminal Flag tag.
Синоним гена:TR; PRP; TPx; TSA; TDX1; NkefB; PrxII; TPx-B; Tdpx1; Torin; Band-8; AL022839
Виды:Mouse
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51862-ACGRBS15400
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51862-ACRRBS15400
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51862-ANGRBS15400
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51862-ANRRBS15400
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51862-CFRBS13340
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51862-CHRBS13340
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51862-CMRBS13340
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51862-CYRBS13340
Мышь Peroxiredoxin 2/PRDX2 Джин клон кДНК в вектор клонированияMG51862-GRBS5130
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51862-NFRBS13340
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51862-NHRBS13340
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51862-NMRBS13340
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51862-NYRBS13340
Мышь Peroxiredoxin 2/PRDX2 Джин ORF экспрессии кДНК клона плазмидыMG51862-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Peroxiredoxin-2, also known as Natural killer cell-enhancing factor B, NKEF-B, Thiol-specific antioxidant protein, Thioredoxin peroxidase 1, Thioredoxin-dependent peroxide reductase 1, PRDX2 and NKEFB, is a cytoplasm protein which belongs to the ahpC / TSA family. Peroxiredoxin-2 / PRDX2 contains one thioredoxin domain. Peroxiredoxin-2 / PRDX2 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-2 / PRDX2 is not able to receive electrons from glutaredoxin. It may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-2 / PRDX2 might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2.

The Peroxiredoxins / Prx are a family of peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

Ссылки
  • Cha M.-K., et al., 1995,  Biochem. Biophys. Res. Commun. 217:900-7.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Chevallet M., et al., 2003, J. Biol. Chem. 278:37146-53.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    Каталог: MG51862-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».