After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRDX1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011034.4
Размер кДНК:600bp
Описание кДНК:Full length Clone DNA of Mus musculus peroxiredoxin 1 with N terminal HA tag.
Синоним гена:PAG, OSF3, Paga, PrxI, TDX2, TPxA, prx1, MSP23, NkefA, OSF-3, PrdxI, Tdpx2, Prdx1
Виды:Mouse
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50552-ACGRBS15400
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50552-ACRRBS15400
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50552-ANGRBS15400
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50552-ANRRBS15400
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50552-CFRBS13340
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50552-CHRBS13340
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50552-CMRBS13340
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50552-CYRBS13340
Мышь Peroxiredoxin 1/PRDX1 Джин клон кДНК в вектор клонированияMG50552-MRBS5130
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50552-NFRBS13340
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50552-NHRBS13340
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50552-NMRBS13340
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50552-NYRBS13340
Мышь Peroxiredoxin 1/PRDX1 Джин ORF экспрессии кДНК клона плазмидыMG50552-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

Ссылки
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Каталог: MG50552-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».