PPP2R5E cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

PPP2R5E cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Description
Full length Clone DNA of Mouse protein phosphatase 2, regulatory subunit B', epsilon with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PPP2R5E cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

4633401M22Rik cDNA ORF Clone, Mouse; AI449017 cDNA ORF Clone, Mouse; B56beta cDNA ORF Clone, Mouse

PPP2R5E Background Information

Full Name
protein phosphatase 2, regulatory subunit B', epsilon isoform
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait