After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PPM1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_008910.2
Размер кДНК:1149bp
Описание кДНК:Full length Clone DNA of Mus musculus protein phosphatase 1A, magnesium dependent, alpha isoform.
Синоним гена:MMPa-2, MPPa-1, AI427932, AU017636, 2310003C21Rik, 2900017D14Rik, Ppm1a
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50277-ACGRBS15400
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50277-ACRRBS15400
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50277-ANGRBS15400
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50277-ANRRBS15400
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50277-CFRBS13340
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50277-CHRBS13340
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50277-CMRBS13340
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50277-CYRBS13340
Мышь PPM1A/PP2CA Джин клон кДНК в вектор клонированияMG50277-MRBS5130
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50277-NFRBS13340
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50277-NHRBS13340
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50277-NMRBS13340
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50277-NYRBS13340
Мышь PPM1A/PP2CA Джин ORF экспрессии кДНК клона плазмидыMG50277-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Protein phosphatase 1A (PPM1A / PP2CA) is an enzyme belonging to the PP2C family of Ser / Thr protein phosphatases. Members of PP2C family are negative regulators of cell stress response pathways and the MAP kinases and MAP kinase kinases. It has also been demonstrated to inhibit the activation of p38 and JNK kinase cascades. PPM1A dephosphorylates and promotes nuclear export of TGFβ-activated Smad2/3. Ectopic expression of PPM1A abolishes TGFβ-induced antiproliferative and transcriptional responses, whereas depletion of PPM1A enhances TGFβ signaling in mammalian cells. It has been demonstrated that PPM1A / PP2CA, through dephosphorylation of Smad2/3, plays a critical role in terminating TGFβ signaling. Overexpression of PPM1A is reported to activate the expression of the tumor suppressor gene TP53 / p53, which leads to cell apoptosis.

Ссылки
  • Lin X, et al. (2006) PPM1A functions as a Smad phosphatase to terminate TGFbeta signaling. Cell. 125(5): 915-28.
  • Marc F, et al. (2003) Protein phosphatase 2C binds selectively to and dephosphorylates metabotropic glutamate receptor 3. Proc Natl Acad. 100 (26): 16006-11.
  • Mann DJ, et al. (1992) Mammalian protein serine/threonine phosphatase 2C: cDNA cloning and comparative analysis of amino acid sequences. Biochim Biophys Acta. 1130 (1): 100-4.
  • Size / Price
    Каталог: MG50277-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».