Быстрый заказ

Text Size:AAA

Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PPAP2B Информация о продукте «Клон cDNA»
Размер кДНК:939bp
Описание кДНК:Full length Clone DNA of Mus musculus phosphatidic acid phosphatase type 2B with N terminal Myc tag.
Синоним гена:Lpp3, Ppab2b, AV025606, D4Bwg0538e, D4Bwg1535e, 1110003O22Rik, 2610002D05Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52591-ACGRBS15396
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52591-ACRRBS15396
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52591-CFRBS13343
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52591-CHRBS13343
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52591-CMRBS13343
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52591-CYRBS13343
Mouse PPAP2B Gene cDNA clone plasmidMG52591-GRBS5130
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52591-NFRBS13343
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52591-NHRBS13343
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52591-NMRBS13343
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52591-NYRBS13343
Мышь PARP3 Джин клон кДНК в вектор клонированияMG52591-URBS5132
Мышь PARP3 Джин ORF экспрессии кДНК клона плазмидыMG52591-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52591-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.