Быстрый заказ

Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Мышь POSTN Информация о продукте «Клон cDNA»
Размер кДНК:2436bp
Описание кДНК:Full length Clone DNA of Mus musculus periostin, osteoblast specific factor with N terminal Flag tag.
Синоним гена:PN, Osf2, peri, OSF-2, AI747096, Periostin
Участок рестрикции:KpnI (two restriction sites) + XbaI (6kb+1.73kb+0.73kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 471T/A, 1470T/C, 1494A/G, 1920T/C, 2238T/C not causing the amino acid variation.
( We provide with POSTN qPCR primers for gene expression analysis, MP200090 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь POSTN Gene Plasmid Map
Mouse POSTN natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50450-ACGRBS16760
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50450-ACRRBS16760
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50450-CFRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50450-CHRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50450-CMRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50450-CYRBS14710
Мышь Periostin/POSTN/OSF-2 Джин клон кДНК в вектор клонированияMG50450-MRBS5130
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50450-NFRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50450-NHRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50450-NMRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50450-NYRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмидыMG50450-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Size / Price
    Каталог: MG50450-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    • Mouse Periostin/POSTN/OSF-2 Gene Expression validated Image 16489
    • Mouse POSTN natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.