After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse POSTN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015784.2
Размер кДНК:2436bp
Описание кДНК:Full length Clone DNA of Mus musculus periostin, osteoblast specific factor with C terminal His tag.
Синоним гена:PN, Osf2, peri, OSF-2, AI747096, Periostin
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:pCMV3-mPOSTN-His
Участок рестрикции:KpnI (two restriction sites) + XbaI (6kb + 1.78kb + 0.71kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 453T/A, 1452T/C, 1476A/G, 1902T/C, 2220T/C  not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse POSTN Gene Plasmid Map
Mouse POSTN ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50450-ACGRBS16760
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50450-ACRRBS16760
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50450-CFRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50450-CHRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50450-CMRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50450-CYRBS14710
Мышь Periostin/POSTN/OSF-2 Джин клон кДНК в вектор клонированияMG50450-MRBS5130
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50450-NFRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50450-NHRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50450-NMRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50450-NYRBS14710
Мышь Periostin/POSTN/OSF-2 Джин ORF экспрессии кДНК клона плазмидыMG50450-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

Ссылки
  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.
  • Size / Price
    Каталог: MG50450-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
    • Mouse POSTN ORF mammalian expression plasmid, C-His tag
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».