POR/CYPOR cDNA ORF Clone, Mouse, N-His tag

Cat: MG51838-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All POR/CYPOR Reagents

CRO Services

Product recommended


All POR/CYPOR Reagents

POR/CYPOR cDNA ORF Clone, Mouse, N-His tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2037 bp
Description
Full length Clone DNA of Mouse P450 (cytochrome) oxidoreductase with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

POR/CYPOR cDNA ORF Clone, Mouse, N-His tag Alternative Names

4933424M13Rik cDNA ORF Clone, Mouse;CPR cDNA ORF Clone, Mouse;CYPOR cDNA ORF Clone, Mouse

POR/CYPOR Background Information

Full Name
P450 (cytochrome) oxidoreductase

POR/CYPOR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
POR/CYPOR cDNA ORF Clone in Cloning Vector, Mouse MG51838-G
POR/CYPOR cDNA ORF Clone, Mouse, untagged MG51838-UT
POR/CYPOR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51838-ACGLN
POR/CYPOR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51838-ACG
POR/CYPOR cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51838-ANG
POR/CYPOR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51838-ACR
POR/CYPOR cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51838-ANR
POR/CYPOR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51838-CF
POR/CYPOR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51838-NF
POR/CYPOR cDNA ORF Clone, Mouse, C-His tag MG51838-CH
POR/CYPOR cDNA ORF Clone, Mouse, C-HA tag MG51838-CY
POR/CYPOR cDNA ORF Clone, Mouse, N-HA tag MG51838-NY
POR/CYPOR cDNA ORF Clone, Mouse, C-Myc tag MG51838-CM
POR/CYPOR cDNA ORF Clone, Mouse, N-Myc tag MG51838-NM
POR/CYPOR qPCR Primer Pairs, Mouse MP201711

POR/CYPOR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
POR/CYPOR cDNA ORF Clone in Cloning Vector, Human HG10365-M
POR/CYPOR cDNA ORF Clone, Human, untagged HG10365-UT
POR/CYPOR cDNA ORF Clone, Human, C-GFPSpark® tag HG10365-ACG
POR/CYPOR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10365-ACGLN
POR/CYPOR cDNA ORF Clone, Human, N-GFPSpark® tag HG10365-ANG
POR/CYPOR cDNA ORF Clone, Human, C-OFPSpark® tag HG10365-ACR
POR/CYPOR cDNA ORF Clone, Human, N-OFPSpark® tag HG10365-ANR
POR/CYPOR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10365-CF
POR/CYPOR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10365-NF
POR/CYPOR cDNA ORF Clone, Human, C-His tag HG10365-CH
POR/CYPOR cDNA ORF Clone, Human, N-His tag HG10365-NH
POR/CYPOR cDNA ORF Clone, Human, C-HA tag HG10365-CY
POR/CYPOR cDNA ORF Clone, Human, N-HA tag HG10365-NY
POR/CYPOR cDNA ORF Clone, Human, C-Myc tag HG10365-CM
POR/CYPOR cDNA ORF Clone, Human, N-Myc tag HG10365-NM
POR/CYPOR qPCR Primer Pairs, Human HP100400
info info
添加购物车成功! 添加购物车失败!