After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь POMP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse POMP Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_025624.2
Размер кДНК:426bp
Описание кДНК:Full length Clone DNA of Mus musculus proteasome maturation protein.
Синоним гена:Ump1, 2510048O06Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51385-ACGRBS15400
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51385-ACRRBS15400
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51385-ANGRBS15400
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51385-ANRRBS15400
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51385-CFRBS13340
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51385-CHRBS13340
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51385-CMRBS13340
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51385-CYRBS13340
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51385-NFRBS13340
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51385-NHRBS13340
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51385-NMRBS13340
Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51385-NYRBS13340
Мышь POMP Джин клон кДНК в вектор клонированияMG51385-URBS5130
Мышь POMP Джин ORF экспрессии кДНК клона плазмидыMG51385-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51385-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».