Быстрый заказ

Мышь POMP Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь POMP Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_025624.2
    Размер кДНК:426bp
    Описание кДНК:Full length Clone DNA of Mus musculus proteasome maturation protein.
    Синоним гена:Ump1, 2510048O06Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with POMP qPCR primers for gene expression analysis, MP201258 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51385-ACGRBS15400
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51385-ACRRBS15400
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51385-ANGRBS15400
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51385-ANRRBS15400
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51385-CFRBS13340
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51385-CHRBS13340
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51385-CMRBS13340
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51385-CYRBS13340
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51385-NFRBS13340
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51385-NHRBS13340
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51385-NMRBS13340
    Мышь POMP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51385-NYRBS13340
    Мышь POMP Джин клон кДНК в вектор клонированияMG51385-URBS5130
    Мышь POMP Джин ORF экспрессии кДНК клона плазмидыMG51385-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51385-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».