After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse POMGNT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026651.2
Размер кДНК:1983bp
Описание кДНК:Full length Clone DNA of Mus musculus protein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase with C terminal Flag tag.
Синоним гена:0610016I07Rik, 4930467B06Rik, RP23-319H15.3
Виды:Mouse
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52217-ACGRBS16760
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52217-ACRRBS16760
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52217-CFRBS14710
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52217-CHRBS14710
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52217-CMRBS14710
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52217-CYRBS14710
Мышь POMGNT1 Джин клон кДНК в вектор клонированияMG52217-GRBS5130
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52217-NFRBS14710
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52217-NHRBS14710
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52217-NMRBS14710
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52217-NYRBS14710
Мышь POMGNT1 Джин ORF экспрессии кДНК клона плазмидыMG52217-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52217-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».