Быстрый заказ

Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse POLR3C Информация о продукте «Клон cDNA»
Размер кДНК:1602bp
Описание кДНК:Full length Clone DNA of Mus musculus polymerase (RNA) III (DNA directed) polypeptide C with N terminal Myc tag.
Синоним гена:RPC3, RPC62, 4933407E01Rik
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51462-ACGRBS16760
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51462-ACRRBS16760
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51462-ANGRBS16760
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51462-ANRRBS16760
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51462-CFRBS14710
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51462-CHRBS14710
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51462-CMRBS14710
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51462-CYRBS14710
Мышь POLR3C Джин клон кДНК в вектор клонированияMG51462-GRBS5130
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51462-NFRBS14710
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51462-NHRBS14710
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51462-NMRBS14710
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51462-NYRBS14710
Мышь POLR3C Джин ORF экспрессии кДНК клона плазмидыMG51462-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51462-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.