After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PLA2G4A Информация о продукте «Клон cDNA»
Размер кДНК:2247bp
Описание кДНК:Full length Clone DNA of Mus musculus phospholipase A2, group IVA (cytosolic, calcium-dependent) with C terminal His tag.
Синоним гена:cPLA2, Pla2g4, cPLA2alpha
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51714-ACGRBS16760
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51714-ACRRBS16760
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51714-ANGRBS16760
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51714-ANRRBS16760
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51714-CFRBS14710
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51714-CHRBS14710
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51714-CMRBS14710
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51714-CYRBS14710
Мышь PLA2G4A Джин клон кДНК в вектор клонированияMG51714-GRBS5130
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51714-NFRBS14710
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51714-NHRBS14710
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51714-NMRBS14710
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51714-NYRBS14710
Мышь PLA2G4A Джин ORF экспрессии кДНК клона плазмидыMG51714-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51714-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.