After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PLA2G2A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001082531.1
Размер кДНК:441bp
Описание кДНК:Full length Clone DNA of Mus musculus phospholipase A2, group IIA (platelets, synovial fluid) with N terminal Myc tag.
Синоним гена:EF, Mom1, Pla2, sPLA2, sPla2-IIA, Pla2g2a
Виды:Mouse
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50203-ACGRBS15400
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50203-ACRRBS15400
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50203-CFRBS13340
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50203-CHRBS13340
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50203-CMRBS13340
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50203-CYRBS13340
Мышь PLA2G2A Джин клон кДНК в вектор клонированияMG50203-GRBS5130
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50203-NFRBS13340
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50203-NHRBS13340
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50203-NMRBS13340
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50203-NYRBS13340
Мышь PLA2G2A Джин ORF экспрессии кДНК клона плазмидыMG50203-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Phospholipase A2, membrane associated, also known as Phosphatidylcholine 2-acylhydrolase 2A, Group IIA phospholipase A2, Non-pancreatic secretory phospholipase A2 and PLA2G2A, is a peripheral membrane protein which belongs to the phospholipase A2 family. PLA2G2A is found in many cells and also extracellularly. The membrane-bound and secreted forms of PLA2G2A are identical. PLA2G2A has been proposed to play a role in anti-bacterial defense, inflammation and eicosanoid generation, in clearance of apoptotic cells, and in the Wnt signaling pathway. PLA2G2A is thought to participate in the regulation of the phospholipid metabolism in biomembranes including eicosanoid biosynthesis. PLA2G2A catalyzes the calcium-dependent hydrolysis of the 2-acyl groups in 3-sn-phosphoglycerides. PLA2G2A might be a factor in human colorectal tumorigenesis.

Ссылки
  • Praml,C. et al., 1998, Oncogene. 17 (15):2009-12.
  • Fijneman,R.J. et al., 2008,Front Biosci 13 :4144-74.
  • Fijneman,R.J. et al., 2009, Cell Oncol  31 (5):345-56.
  • Size / Price
    Каталог: MG50203-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».