After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PLA2G1B Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_011107.1
Размер кДНК:441bp
Описание кДНК:Full length Clone DNA of Mus musculus phospholipase A2, group IB, pancreas with C terminal Myc tag.
Синоним гена:Pla2a, MGC6679, sPLA2IB, Pla2g1b
Виды:Mouse
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50329-ACGRBS15396
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50329-ACRRBS15396
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50329-CFRBS13343
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50329-CHRBS13343
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50329-CMRBS13343
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50329-CYRBS13343
Мышь PLA2G1B Джин клон кДНК в вектор клонированияMG50329-MRBS5132
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50329-NFRBS13343
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50329-NHRBS13343
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50329-NMRBS13343
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50329-NYRBS13343
Мышь PLA2G1B Джин ORF экспрессии кДНК клона плазмидыMG50329-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Mouse phospholipase A2, also known as Phosphatidylcholine 2-acylhydrolase 1B, Group IB phospholipase A2, PLA2 and PLA2G1B, is a secreted protein which belongs to the phospholipase A2 family. Phospholipase A2 / PLA2G1B catalyzes the release of fatty acids from glycero-3-phosphocholines. The best known varieties are the digestive enzymes secreted as zymogens by the pancreas of mammals. Sequences of pancreatic Phospholipase A2 / PLA2G1B enzymes from a variety of mammals have been reported. One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of Phospholipase A2 / PLA2G1B have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets. Mice lacking in Phospholipase A2 / PLA2G1B are resistant to obesity and diabetes induced by feeding a diabetogenic high-fat/high-carbohydrate diet. Oral supplementation of a diabetogenic diet with the PLA2G1B inhibitor methyl indoxam effectively suppresses diet-induced obesity and diabetes. PLA2G1B inhibition may be a potentially effective oral therapeutic option for treatment of obesity and diabetes.

Ссылки
  • Labonté,E.D. et al., 2006, Diabetes. 55 (4) :935-41.
  • Mounier,C.M. et al.,2008, Br J Cancer. 98 (3):587-95.
  • Hui,D.Y. et al., 2009, Br J Pharmacol. 157 (7):1263-9.
  • Labonté,E.D. et al., 2010, FASEB J. 24 (7):2516-24.
  • Size / Price
    Каталог: MG50329-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».