After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRKD3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_029239.3
Размер кДНК:2670bp
Описание кДНК:Full length Clone DNA of Mus musculus protein kinase D3 with N terminal Flag tag.
Синоним гена:PKD3, Pkcnu, Prkcn, MGC47171, 4930557O20Rik, 5730497N19Rik, Prkd3
Виды:Mouse
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51080-ACGRBS22240
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51080-ACRRBS22240
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51080-ANGRBS22240
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51080-ANRRBS22240
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51080-CFRBS20190
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51080-CHRBS20190
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51080-CMRBS20190
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51080-CYRBS20190
Мышь PKC-nu/PRKD3 Джин клон кДНК в вектор клонированияMG51080-GRBS5130
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51080-NFRBS20190
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51080-NHRBS20190
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51080-NMRBS20190
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51080-NYRBS20190
Мышь PKC-nu/PRKD3 Джин ORF экспрессии кДНК клона плазмидыMG51080-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Serine/threonine-protein kinase D3, also known as Protein kinase C nu type, Protein kinase EPK2, PRKD3, EPK2 and PRKCN, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD3 / PRKCN contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. They also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. PRKD3 / PRKCN converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. It is involved in resistance to oxidative stress. PRKD3 / PRKCN is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains 1 and 2 bind both DAG and phorbol ester with high affinity and mediate translocation to the cell membrane. Autophosphorylation of Ser-735 and phosphorylation of Ser-731 by PKC relieves auto-inhibition by the PH domain. PRKD3 / PRKCN can be activated rapidly by the agonists of G protein-coupled receptors. It resides in both cytoplasm and nucleus, and its nuclear accumulation is found to be dramatically enhanced in response to its activation. PRKD3 / PRKCN can also be activated after B-cell antigen receptor (BCR) engagement, which requires intact phospholipase C gamma and the involvement of other PKC family members.

Ссылки
  • Schultz SJ, et al.,1994, Cell Growth Differ. 4 (10): 821-30.
  • Hayashi A, et al., 1999, Biochim Biophys Acta 1450 (1): 99-106.
  • Mayne M, et al., 2000, J. Immunol. 164 (12): 6538-42.
  • Ali A, et al., 2002, Chem. Rev. 101 (8): 2527-40.
  • Size / Price
    Каталог: MG51080-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».