Быстрый заказ

Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PRKCD Информация о продукте «Клон cDNA»
Размер кДНК:2025bp
Описание кДНК:Full length Clone DNA of Mus musculus protein kinase C, delta with C terminal Myc tag.
Синоним гена:Pkcd, PKC[d], AI385711, PKCdelta, D14Ertd420e, Prkcd
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50345-ACGRBS16760
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50345-ACRRBS16760
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG50345-ANGRBS16760
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG50345-ANRRBS16760
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50345-CFRBS14710
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50345-CHRBS14710
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50345-CMRBS14710
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50345-CYRBS14710
Мышь PRKCD Джин клон кДНК в вектор клонированияMG50345-MRBS5130
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50345-NFRBS14710
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50345-NHRBS14710
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50345-NMRBS14710
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50345-NYRBS14710
Мышь PRKCD Джин ORF экспрессии кДНК клона плазмидыMG50345-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Cross T, et al. (2000) PKC-delta is an apoptotic lamin kinase. Oncogene. 19(19): 2331-7.
  • Song JS, et al. (1998) Tyrosine phosphorylation-dependent and -independent associations of protein kinase C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src family kinase activity by protein kinase C-delta. Oncogene. 16(26): 3357-68.
  • Shanmugam M, et al. (1998) Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16(13): 1649-54.
  • Size / Price
    Каталог: MG50345-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.