After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PHYKPL Информация о продукте «Клон cDNA»
Размер кДНК:1404bp
Описание кДНК:Full length Clone DNA of Mus musculus 5-phosphohydroxy-L-lysine phospholyase with N terminal HA tag.
Синоним гена:Agxt2l2, RP23-79E13.3, 2900006B13Rik
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51996-ACGRBS15400
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51996-ACRRBS15400
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51996-ANGRBS15400
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51996-ANRRBS15400
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51996-CFRBS13340
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51996-CHRBS13340
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51996-CMRBS13340
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51996-CYRBS13340
Мышь AGXT2L2 Джин клон кДНК в вектор клонированияMG51996-GRBS5130
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51996-NFRBS13340
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51996-NHRBS13340
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51996-NMRBS13340
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51996-NYRBS13340
Мышь AGXT2L2 Джин ORF экспрессии кДНК клона плазмидыMG51996-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51996-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.