Быстрый заказ

Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PHC2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001195083.1
    Размер кДНК:972bp
    Описание кДНК:Full length Clone DNA of Mus musculus polyhomeotic-like 2 (Drosophila) with C terminal His tag.
    Синоним гена:p36, Edr2, Mph2, A3galt2, AA415044, D4Ertd810e, D130050K19Rik
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PHC2 qPCR primers for gene expression analysis, MP202171 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52298-ACGRBS15400
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52298-ACRRBS15400
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52298-ANGRBS15400
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52298-ANRRBS15400
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52298-CFRBS13340
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52298-CHRBS13340
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52298-CMRBS13340
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52298-CYRBS13340
    Мышь PHC2 Джин клон кДНК в вектор клонированияMG52298-GRBS5130
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52298-NFRBS13340
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52298-NHRBS13340
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52298-NMRBS13340
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52298-NYRBS13340
    Мышь PHC2 Джин ORF экспрессии кДНК клона плазмидыMG52298-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».