Быстрый заказ

Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PFN2 Информация о продукте «Клон cDNA»
Размер кДНК:423bp
Описание кДНК:Full length Clone DNA of Mus musculus profilin 2 with C terminal Myc tag.
Синоним гена:Pfn
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51608-ACGRBS15400
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51608-ACRRBS15400
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51608-ANGRBS15400
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51608-ANRRBS15400
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51608-CFRBS13340
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51608-CHRBS13340
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51608-CMRBS13340
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51608-CYRBS13340
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51608-NFRBS13340
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51608-NHRBS13340
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51608-NMRBS13340
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51608-NYRBS13340
Мышь Profilin 2 / PFN2 Джин клон кДНК в вектор клонированияMG51608-URBS5130
Мышь Profilin 2 / PFN2 Джин ORF экспрессии кДНК клона плазмидыMG51608-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Profilin 2, also known as PFN2, is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is highly expressed in brain, skeletal muscle and kidney and less strongly in heart, placenta, lung and liver. Profilin 2 binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations. Profilin 2 is thought to regulate actin polymerization in response to extracellular signals. It inhibits the formation of IP3 and DG by binding to PIP2.

  • Da Silva. et al., 2003, J Cell Biol. 162 (7): 1267-79.
  • Honore B. et al., 1993, FEBS Lett. 330 (2): 151-5.
  • Joensuu T. et al., 1997, Genomics. 38 (3): 255-63.
  • Size / Price
    Каталог: MG51608-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.