After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PEBP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:AB046417.1
Размер кДНК:564bp
Описание кДНК:Full length Clone DNA of Mus musculus phosphatidylethanolamine binding protein 1.
Синоним гена:Pbp, HCNP, Pbp1, Pbpr, Rkip
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51347-ACGRBS15396
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51347-ACRRBS15396
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51347-ANGRBS15396
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51347-ANRRBS15396
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51347-CFRBS13343
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51347-CHRBS13343
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51347-CMRBS13343
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51347-CYRBS13343
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51347-NFRBS13343
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51347-NHRBS13343
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51347-NMRBS13343
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51347-NYRBS13343
Мышь PEBP1/RKIP Джин клон кДНК в вектор клонированияMG51347-URBS5132
Мышь PEBP1/RKIP Джин ORF экспрессии кДНК клона плазмидыMG51347-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51347-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».