Быстрый заказ

Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PDPN Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_010329.2
    Размер кДНК:519bp
    Описание кДНК:Full length Clone DNA of Mus musculus podoplanin.
    Синоним гена:T1a, Gp38, OTS-8, PA2.26, T1alpha, RANDAM-2, Pdpn
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PDPN qPCR primers for gene expression analysis, MP200282 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50256-ACGRBS15400
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50256-ACRRBS15400
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50256-CFRBS13340
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50256-CHRBS13340
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50256-CMRBS13340
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50256-CYRBS13340
    Мышь Podoplanin Джин клон кДНК в вектор клонированияMG50256-MRBS5130
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50256-NFRBS13340
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50256-NHRBS13340
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50256-NMRBS13340
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50256-NYRBS13340
    Мышь Podoplanin Джин ORF экспрессии кДНК клона плазмидыMG50256-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Podoplanin, also known as PDPN, is a type-I integral membrane glycoprotein with diverse distribution in human tissues. The physiological function of this protein may be related to its mucin-type character. The homologous protein in other species has been described as a differentiation antigen and influenza-virus receptor. The specific function of this protein has not been determined. Alternatively spliced transcript variants encoding different isoforms have been identified.PDPN is a mucin-type glycoprotein negatively charged by extensive O-glycosylation and a high content of sialic acid, which expresses the adhesive property. It is selectively expressed in lymphatic endothelium as well as lymphangiomas, Kaposi sarcomas, and in a subset of angiosarcomas with probable lymphatic differentiation. PDPN may contribute to form odontoblastic fiber or function as the anchorage to the tooth development and in proliferating epithelial cells of cervical loop and apical bud. The intensity of podoplanin expression is negatively correlated with the expression of CD34 and factor VIII. Podoplanin would be useful as a diagnostic marker for epithelioid hemangioendothelioma in liver tumors.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Kimura, N. et al., 2005,  Pathol Int. 55 (2): 83-86.
  • Ordóñez, N.G., 2006, Adv Anat Pathol. 13 (2): 83-88.
  • Wicki, A. et al., 2007,  Br. J. Cancer. 96 (1): 1-5.
  • Fujii,T. et al., 2008, Mod Pathol. 21 (2): 125-130.
  • Sawa,Y. et al., 2008, Acta Histochem Cytochem. 41 (5):121-126.
  • Kaddu, S. et al., 2009, Am J Dermatopathol.  31 (2): 137-139.
  • Size / Price
    Каталог: MG50256-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».