Быстрый заказ

Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PDGFA Информация о продукте «Клон cDNA»
Размер кДНК:591bp
Описание кДНК:Full length Clone DNA of Mus musculus platelet derived growth factor, alpha with C terminal His tag.
Синоним гена:Pdgfa
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50447-ACGRBS15400
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50447-ACRRBS15400
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50447-CFRBS13340
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50447-CHRBS13340
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50447-CMRBS13340
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50447-CYRBS13340
Мышь PDGFA/PDGF-1 Джин клон кДНК в вектор клонированияMG50447-MRBS5130
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50447-NFRBS13340
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50447-NHRBS13340
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50447-NMRBS13340
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50447-NYRBS13340
Мышь PDGFA/PDGF-1 Джин ORF экспрессии кДНК клона плазмидыMG50447-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG50447-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.