Быстрый заказ

Text Size:AAA

Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PDGFC Информация о продукте «Клон cDNA»
Размер кДНК:1038bp
Описание кДНК:Full length Clone DNA of Mus musculus platelet-derived growth factor, C polypeptide with N terminal Flag tag.
Синоним гена:PDGF-C, AI647969, 1110064L01Rik
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50458-ACGRBS15400
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50458-ACRRBS15400
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50458-CFRBS13340
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50458-CHRBS13340
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50458-CMRBS13340
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50458-CYRBS13340
Мышь PDGF-C Джин клон кДНК в вектор клонированияMG50458-MRBS5130
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50458-NFRBS13340
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50458-NHRBS13340
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50458-NMRBS13340
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50458-NYRBS13340
Мышь PDGF-C Джин ORF экспрессии кДНК клона плазмидыMG50458-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

PDGF-C is a member of the PDGF/VEGF family of growth factors with a unique domain organization and expression pattern. Platelet-derived growth factor receptors (PDGFRs) are catalytic receptors that have intracellular tyrosine kinase activity. They have roles in the regulation of many biological processes including embryonic development, angiogenesis, cell proliferation and differentiation, and contribute to the pathophysiology of some diseases, including cancer. There are two isoforms of the PDGFR receptor; PDGFRalpha and PDGFRbeta, which can form homo- or heterodimers. The endogenous PDGFR ligands are PDGF-A, -B, -C and -D, which induce receptor dimerization and transphosphorylation at specific tyrosine residues upon binding. This activates the intracellular kinase activity, initiating intracellular signaling through the MAPK, PI 3-K and PKCgamma pathways. PDGF-C acts as a specific ligand for alpha platelet-derived growth factor receptor homodimer, and alpha and beta heterodimer. Binding of this growth factor to its affinity receptor elicits a variety of cellular responses. PDGF-C Appears to be involved in the three stages of wound healing: inflammation, proliferation and remodeling. Involved in fibrotic processes, in which transformation of interstitial fibroblasts into myofibroblasts plus collagen deposition occurs.

  • Li X, et al. (2000) PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol. 2 (5): 302-9.
  • Ding H, et al. (2004) A specific requirement for PDGF-C in palate formation and PDGFR-alpha signaling. Nat Genet. 36 (10): 1111-6.
  • Choi SJ, et al. (2009) The PDGF-C regulatory region SNP rs28999109 decreases promoter transcriptional activity and is associated with CL/P. European Journal of Human Genetics. 17 (11): 774-84.
  • Size / Price
    Каталог: MG50458-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.