Быстрый заказ

Text Size:AAA

Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PDE4B Информация о продукте «Клон cDNA»
Размер кДНК:1695bp
Описание кДНК:Full length Clone DNA of Mus musculus phosphodiesterase 4B, cAMP specific with N terminal His tag.
Синоним гена:Dpde4; dunce; R74983
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51965-ACGRBS16760
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51965-ACRRBS16760
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51965-ANGRBS16760
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51965-ANRRBS16760
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51965-CFRBS14710
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51965-CHRBS14710
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51965-CMRBS14710
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51965-CYRBS14710
Mouse PDE4B Gene cDNA clone plasmidMG51965-GRBS5130
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51965-NFRBS14710
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51965-NHRBS14710
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51965-NMRBS14710
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51965-NYRBS14710
Мышь PDE4B Джин клон кДНК в вектор клонированияMG51965-URBS5130
Мышь PDE4B Джин ORF экспрессии кДНК клона плазмидыMG51965-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents

  • Bolger G.et al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card G.L.et al., 2004, Structure 12:2233-47.
  • Card G.L.et al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang H.et al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • Size / Price
    Каталог: MG51965-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.