After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PDCL3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026850.4
Размер кДНК:723bp
Описание кДНК:Full length Clone DNA of Mus musculus phosducin-like 3.
Синоним гена:Viaf1, C80025, 1110061A19Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52471-ACGRBS15400
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52471-ACRRBS15400
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52471-ANGRBS15400
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52471-ANRRBS15400
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52471-CFRBS13340
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52471-CHRBS13340
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52471-CMRBS13340
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52471-CYRBS13340
Мышь PDCL3 Джин клон кДНК в вектор клонированияMG52471-GRBS5130
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52471-NFRBS13340
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52471-NHRBS13340
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52471-NMRBS13340
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52471-NYRBS13340
Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмидыMG52471-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG52471-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».