Быстрый заказ

Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PDCL3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_026850.4
    Размер кДНК:723bp
    Описание кДНК:Full length Clone DNA of Mus musculus phosducin-like 3.
    Синоним гена:Viaf1, C80025, 1110061A19Rik
    Виды:Mouse
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PDCL3 qPCR primers for gene expression analysis, MP202344 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52471-ACGRBS15400
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52471-ACRRBS15400
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52471-ANGRBS15400
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52471-ANRRBS15400
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52471-CFRBS13340
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52471-CHRBS13340
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52471-CMRBS13340
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52471-CYRBS13340
    Мышь PDCL3 Джин клон кДНК в вектор клонированияMG52471-GRBS5130
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52471-NFRBS13340
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52471-NHRBS13340
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52471-NMRBS13340
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52471-NYRBS13340
    Мышь PDCL3 Джин ORF экспрессии кДНК клона плазмидыMG52471-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».