After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PDCD2L Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_026549.3
Размер кДНК:1095bp
Описание кДНК:Full length Clone DNA of Mus musculus programmed cell death 2-like.
Синоним гена:6030457N17Rik
Виды:Mouse
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51354-ACGRBS15396
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51354-ACRRBS15396
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51354-ANGRBS15400
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51354-ANRRBS15396
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51354-CFRBS13343
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51354-CHRBS13343
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51354-CMRBS13343
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51354-CYRBS13343
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51354-NFRBS13343
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51354-NHRBS13340
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51354-NMRBS13340
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51354-NYRBS13343
Мышь PDCD2L/MGC13096 Джин клон кДНК в вектор клонированияMG51354-URBS5132
Мышь PDCD2L/MGC13096 Джин ORF экспрессии кДНК клона плазмидыMG51354-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: MG51354-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».