After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PDCD1 Информация о продукте «Клон cDNA»
Размер кДНК:867bp
Описание кДНК:Full length Clone DNA of Mus musculus programmed cell death 1 with N terminal His tag.
Синоним гена:PD-1, Pdc1, Ly101
Участок рестрикции:HindIII + NotI (6kb + 0.92kb)
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Mouse PDCD1 Gene Plasmid Map
Mouse PD1 / PDCD1 natural ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50124-ACGRBS15400
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50124-ACRRBS15400
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50124-CFRBS13340
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50124-CHRBS13340
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50124-CMRBS13340
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50124-CYRBS13340
Мышь PD1/PDCD1/CD279 Джин клон кДНК в вектор клонированияMG50124-MRBS5130
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50124-NFRBS13340
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50124-NHRBS13340
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50124-NMRBS13340
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50124-NYRBS13340
Мышь PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмидыMG50124-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor belonging to the CD28/CTLA-4 family negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase, SHP-2 upon interacting with either of two ligands, PD-L1 or PD-L2. PD1 inhibits the T-cell proliferation and production of related cytokines including IL-1, IL-4, IL-10 and IFN-γ by suppressing the activation and transduction of PI3K/AKT pathway. In addition, coligation of PD1 inhibits BCR-mediating signal by dephosphorylating key signal transducer. PD1 has been suggested to be involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. Furthermore, PD1 is shown to be a regulator of virus-specific CD8+ T cell survival in HIV infection. As a cell surface molecule, PDCD1 regulates the adaptive immune response. Engagement of PD-1 by its ligands PD-L1 or PD-L2 transduces a signal that inhibits T-cell proliferation, cytokine production, and cytolytic function.

  • James ES, et al. (2005) PDCD1: a tissue-specific susceptibility locus for inherited inflammatory disorders. Genes Immun. 6(5): 430-7.
  • Okazaki T, et al. (2007) PD-1 and PD-1 ligands: from discovery to clinical application. Int Immunol. 19(7): 813-24.
  • del Rio ML, et al. (2008) PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 21(11): 1015-28.
  • Riley JL.(2009) PD-1 signaling in primary T cells. Immunol Rev. 229(1): 114-25.
  • Size / Price
    Каталог: MG50124-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    • Mouse PD1 / PDCD1 natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.