Быстрый заказ

Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PCDHGC3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_033581.3
    Размер кДНК:2805bp
    Описание кДНК:Full length Clone DNA of Mus musculus protocadherin gamma subfamily C, 3 with N terminal HA tag.
    Синоним гена:PC43, Pcdh2
    Виды:Mouse
    переносчик:pCMV3-SP-N-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PCDHGC3 qPCR primers for gene expression analysis, MP201896 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52023-ACGRBS22240
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52023-ACRRBS22240
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52023-CFRBS20190
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52023-CHRBS20190
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52023-CMRBS20190
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52023-CYRBS20190
    Мышь PCDHGC3 Джин клон кДНК в вектор клонированияMG52023-GRBS5130
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52023-NFRBS20190
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52023-NHRBS20190
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52023-NMRBS20190
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52023-NYRBS20190
    Мышь PCDHGC3 Джин ORF экспрессии кДНК клона плазмидыMG52023-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG52023-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».