PCBP2 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

PCBP2 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
996 bp
Description
Full length Clone DNA of Mouse poly(rC) binding protein 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PCBP2 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

alphaCP-2 cDNA ORF Clone, Mouse; AW412548 cDNA ORF Clone, Mouse; Hnrpx cDNA ORF Clone, Mouse

PCBP2 Background Information

Poly(rC) binding protein 2 (PCBP2) is an RNA-binding protein that contributes to mRNA stabilization, translational silencing and enhancement and it has been implicated as a promoter of gastric cancer growth.PCBP2, a member of the poly(C)-binding protein (PCBP) family, is involved in posttranscriptional and translational regulation by interacting with single-stranded poly(C) motifs in target mRNAs. Poly(C)binding protein 2 (PCBP2) is a member of the PCBP family, and plays an important role in posttranscriptional and translational regulation of various signaling molecules through direct binding to singlestranded poly(C) motifs. PCBP2 has been reported to play a critical role in the development of multiple human tumors.
Full Name
poly(rC) binding protein 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait