Быстрый заказ

Text Size:AAA

Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse PARK7 Информация о продукте «Клон cDNA»
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Mus musculus Parkinson disease (autosomal recessive, early onset) 7 with C terminal Myc tag.
Синоним гена:Dj1, DJ-1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52768-ACGRBS15400
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52768-ACRRBS15400
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52768-ANGRBS15400
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52768-ANRRBS15400
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52768-CFRBS13340
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52768-CHRBS13340
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52768-CMRBS13340
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52768-CYRBS13340
Мышь PARK7/DJ-1 Джин клон кДНК в вектор клонированияMG52768-GRBS5130
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52768-NFRBS13340
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52768-NHRBS13340
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52768-NMRBS13340
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52768-NYRBS13340
Мышь PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмидыMG52768-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Parkinson's disease locus DJ-1 (PARK7) is a differentially expressed transcript. DJ-1 plays a physiologic role in protection of erythroid cells from oxidant damage, a function unmasked in the context of oxidative stress. PARK7 belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Mutations in the DJ-1 gene are associated with rare forms of autosomal recessive early-onset Parkinson's disease (PD). DJ-1/p53 interactions contribute to apoptosis resistance in clonal myeloid cells and may serve as a prognostic marker in patients with myelodysplastic syndromes (MDS). DJ-1 regulates redox signaling kinase pathways and acts as a transcriptional regulator of antioxidative gene batteries. Therefore, DJ-1 is an important redox-reactive signaling intermediate controlling oxidative stress after ischemia, upon neuroinflammation, and during age-related neurodegenerative processes. Augmenting DJ-1 activity might provide novel approaches to treating chronic neurodegenerative illnesses such as Parkinson's disease and acute damage such as stroke.

  • Takahashi K, et al. (2001). DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor. J. Biol. Chem. (United States). 276 (40): 37556-63.
  • Niki, Takeshi, et al. (2003). DJBP: a novel DJ-1-binding protein, negatively regulates the androgen receptor by recruiting histone deacetylase complex, and DJ-1 antagonizes this inhibition by abrogation of this complex. Mol. Cancer Res. (United States). 1 (4): 247-61.
  • Kahle PJ, et al. (2009) DJ-1 and prevention of oxidative stress in Parkinson's disease and other age-related disorders. Free Radic Biol Med. 47(10): 1354-61.
  • Xu X, et al. (2010) The familial Parkinson's disease gene DJ-1 (PARK7) is expressed in red cells and plays a role in protection against oxidative damage. Blood Cells Mol Dis. 45(3): 227-32.
  • Marcondes AM, et al. (2010) Identification of DJ-1/PARK-7 as a determinant of stroma-dependent and TNF-alpha-induced apoptosis in MDS using mass spectrometry and phosphopeptide analysis. Blood. 115(10): 1993-2002.
  • Size / Price
    Каталог: MG52768-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.