Быстрый заказ

Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь PAK1IP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_026550.3
    Размер кДНК:1149bp
    Описание кДНК:Full length Clone DNA of Mus musculus PAK1 interacting protein 1 with C terminal His tag.
    Синоним гена:PIP1, Gdpd1, AA419825, AI314040, AW556169, 5830431I15Rik, 5930415H02Rik
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PAK1IP1 qPCR primers for gene expression analysis, MP201595 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51722-ACGRBS15400
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51722-ACRRBS15400
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG51722-ANGRBS15400
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG51722-ANRRBS15400
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51722-CFRBS13340
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51722-CHRBS13340
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51722-CMRBS13340
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51722-CYRBS13340
    Мышь PAK1IP1 Джин клон кДНК в вектор клонированияMG51722-GRBS5130
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51722-NFRBS13340
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51722-NHRBS13340
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51722-NMRBS13340
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51722-NYRBS13340
    Мышь PAK1IP1 Джин ORF экспрессии кДНК клона плазмидыMG51722-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: MG51722-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».