After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse OXR1 Информация о продукте «Клон cDNA»
Размер кДНК:651bp
Описание кДНК:Full length Clone DNA of Mus musculus oxidation resistance 1 with C terminal Flag tag.
Синоним гена:C7, C7B, 2210416C20Rik
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG52208-ACGRBS15400
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG52208-ACRRBS15400
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаMG52208-ANGRBS15400
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаMG52208-ANRRBS15400
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG52208-CFRBS13340
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG52208-CHRBS13340
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG52208-CMRBS13340
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG52208-CYRBS13340
Мышь OXR1 Джин клон кДНК в вектор клонированияMG52208-GRBS5130
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG52208-NFRBS13340
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG52208-NHRBS13340
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG52208-NMRBS13340
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG52208-NYRBS13340
Мышь OXR1 Джин ORF экспрессии кДНК клона плазмидыMG52208-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.