After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse OSM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001013365.1
Размер кДНК:792bp
Описание кДНК:Full length Clone DNA of Mus musculus Oncostatin M with N terminal His tag.
Синоним гена:OSM
Виды:Mouse
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50112-ACGRBS15396
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50112-ACRRBS15396
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50112-CFRBS13343
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50112-CHRBS13343
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50112-CMRBS13343
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50112-CYRBS13343
Мышь Oncostatin M/OSM Джин клон кДНК в вектор клонированияMG50112-MRBS5132
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50112-NFRBS13343
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50112-NHRBS13343
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50112-NMRBS13343
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50112-NYRBS13343
Мышь Oncostatin M/OSM Джин ORF экспрессии кДНК клона плазмидыMG50112-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Oncostatin M (OSM) is a glycoprotein belonging to the interleukin-6 family of cytokines that has functions mainly in cell growth. Oncostatin M (OSM) is considered as a pleiotropic cytokine that signals through cell surface receptors typeⅠand typeⅡ both of which share the similarity of containing protein gp130 and takes part in many biometabolism processes including liver development, haematopoeisis, inflammation, bone formation and destruction and possibly CNS development. Oncostatin M (OSM) was previoustly identified by its ability to inhibit the growth of cells from melanoma and other solid tumors. It also has been reported that OSM, like LIF, IL-6 and G-CSF, has the ability to inhibit the proliferation of murine M1 myeloid leukemic cells and can induce their differentiation into macrophage-like cells. The human form of OSM is insensitive between pH2 and 11 and resistant to heating for one hour at 56 degree but is not stable at 90 degrees. The human OSM is produced as a precursor containing 252 amino acids, whose first 25 amino acids function as a secretory signal peptide and which on removal yields the soluble 227 amino acid pro-OSM. Removal of the C-teminal most 31 amino acids produces the fully active 196 residue form.

Ссылки
  • Tanaka M, et al. (2003) Oncostatin M, a multifunctional cytokine. Rev Physiol Biochem Pharmacol. Reviews of Physiology, Biochemistry and Pharmacology. 149: 39-52.
  • Auguste P, et al. (1997) Signaling of type II oncostatin M receptor. J Biol Chem. 272 (25): 15760-4.
  • Zarling JM, et al. (1986). Oncostatin M: a growth regulator produced by differentiated histiocytic lymphoma cells. Proc Natl Acad Sci. 83 (24): 9739-43.
  • Size / Price
    Каталог: MG50112-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».