After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse OPCML Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_177906.4
Размер кДНК:1014bp
Описание кДНК:Full length Clone DNA of Mus musculus opioid binding protein/cell adhesion molecule-like with N terminal Flag tag.
Синоним гена:Gm181, Obcam, AI844366, MGC99974, 3732419F12, C230027C17, 2900075O15Rik, B930023M13Rik, Opcml
Виды:Mouse
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51073-ACGRBS15400
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51073-ACRRBS15400
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51073-CFRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51073-CHRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51073-CMRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51073-CYRBS13340
Мышь OBCAM/OPCML Джин клон кДНК в вектор клонированияMG51073-GRBS5130
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51073-NFRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51073-NHRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51073-NMRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51073-NYRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмидыMG51073-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).

Ссылки
  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • Size / Price
    Каталог: MG51073-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».