Быстрый заказ

Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Мышь OPCML Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_177906.4
    Размер кДНК:1014bp
    Описание кДНК:Full length Clone DNA of Mus musculus opioid binding protein/cell adhesion molecule-like with C terminal His tag.
    Синоним гена:Gm181, Obcam, AI844366, MGC99974, 3732419F12, C230027C17, 2900075O15Rik, B930023M13Rik, Opcml
    Виды:Mouse
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with OPCML qPCR primers for gene expression analysis, MP201031 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51073-ACGRBS15400
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51073-ACRRBS15400
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51073-CFRBS13340
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51073-CHRBS13340
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51073-CMRBS13340
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51073-CYRBS13340
    Мышь OBCAM/OPCML Джин клон кДНК в вектор клонированияMG51073-GRBS5130
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51073-NFRBS13340
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51073-NHRBS13340
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51073-NMRBS13340
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51073-NYRBS13340
    Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмидыMG51073-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).

    Ссылки
  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • Size / Price
    Каталог: MG51073-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».