Быстрый заказ

Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse OPCML Информация о продукте «Клон cDNA»
Размер кДНК:1014bp
Описание кДНК:Full length Clone DNA of Mus musculus opioid binding protein/cell adhesion molecule-like with C terminal His tag.
Синоним гена:Gm181, Obcam, AI844366, MGC99974, 3732419F12, C230027C17, 2900075O15Rik, B930023M13Rik, Opcml
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG51073-ACGRBS15400
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG51073-ACRRBS15400
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG51073-CFRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG51073-CHRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG51073-CMRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG51073-CYRBS13340
Мышь OBCAM/OPCML Джин клон кДНК в вектор клонированияMG51073-GRBS5130
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG51073-NFRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG51073-NHRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG51073-NMRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG51073-NYRBS13340
Мышь OBCAM/OPCML Джин ORF экспрессии кДНК клона плазмидыMG51073-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).

  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • Size / Price
    Каталог: MG51073-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.