After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Mouse OMD Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012050.1
Размер кДНК:1272bp
Описание кДНК:Full length Clone DNA of Mus musculus osteomodulin with C terminal His tag.
Синоним гена:OSAD, SLRR2C
Виды:Mouse
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаMG50451-ACGRBS15400
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаMG50451-ACRRBS15400
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаMG50451-CFRBS13340
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаMG50451-CHRBS13340
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаMG50451-CMRBS13340
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаMG50451-CYRBS13340
Мышь Osteomodulin Джин клон кДНК в вектор клонированияMG50451-MRBS5130
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаMG50451-NFRBS13340
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаMG50451-NHRBS13340
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаMG50451-NMRBS13340
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаMG50451-NYRBS13340
Мышь Osteomodulin Джин ORF экспрессии кДНК клона плазмидыMG50451-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Osteomodulin (OMD), also known as Osteoadherin (OSAD), Keratan sulfate proteoglycan osteomodulin, KSPG osteomodulin, and SLRR2C, is a secreted protein which belongs to the small leucine-rich proteoglycan (SLRP) family and Class II subfamily. SLRP family proteins are normally found in extracellular matrices, but Osteomodulin is the only member restricted to mineralized tissues. Osteomodulin is primarily expressed by osteoblasts and might have a role in regulation of mineralization. In bone OSAD has been localized in primary spongiosa within the bovine fetal rib growth plate. Moreover, in situ hybridization has shown expression of OSAD in osteoblasts close to the cartilage and bone border in the growth plate of rat femur. OSAD may play an important role during tooth development and biomineralization of dentin. Osteomodulin is a cell binding keratan sulfate proteoglycan which was recently isolated from mineralized bovine bone and subsequently cloned and sequenced. Osteomodulin may be implicated in biomineralization processes. It has a function in binding of osteoblasts via the alpha (V) beta (3)-integrin. It is likely that Osteomodulin is an osteoblast maturation marker that is induced by osteoclast activity. Osteomodulin is also an early marker for terminally differentiated matrix producing osteoblasts.

Ссылки
  • Buchaille R, et al. (2000) Expression of the small leucine-rich proteoglycan osteoadherin/osteomodulin in human dental pulp and developing rat teeth. Bone. 27(2): 265-70.
  • Petersson U, et al. (2003) Identification, distribution and expression of osteoadherin during tooth formation. Eur J Oral Sci. 111(2): 128-36.
  • Rehn AP, et al. (2006) Differential regulation of osteoadherin (OSAD) by TGF-beta1 and BMP-2. Biochem Biophys Res Commun. 349(3): 1057-64.
  • Size / Price
    Каталог: MG50451-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».